Cardiopulmonary capacity and muscle strength in transgender women on long-term gender-affirming hormone therapy: a cross-sectional study.

OBJECTIVE: For transgender women (TW) on oestrogen therapy, the effects of prior exposure to testosterone during puberty on their performance, mainly cardiopulmonary capacity (CPC), while exerting physical effort are unknown. Our objective was to evaluate CPC and muscle strength in TW undergoing long-term gender-affirming hormone therapy. METHODS: A cross-sectional study was carried out with 15 TW (34.2±5.2 years old), 13 cisgender men (CM) and 14 cisgender women (CW). The TW received hormone therapy for 14.4±3.5 years. Bioimpedance, the hand grip test and cardiopulmonary exercise testing on a treadmill with an incremental effort were performed. RESULTS: The mean VO2peak (L/min) was 2606±416.9 in TW, 2167±408.8 in CW and 3358±436.3 in CM (TW vs CW, p<0.05; TW vs CM, p<0.0001; CW vs CM, p<0.0001). The O2 pulse in TW was between that in CW and CM (TW vs CW, p<0.05, TW vs CM, p<0.0001). There was a high correlation between VO2peak and fat-free mass/height2 among TW (r=0.7388; p<0.01), which was not observed in the other groups. The mean strength (kg) was 35.3±5.4 in TW, 29.7±3.6 in CW and 48.4±6.7 in CM (TW vs CW, p<0.05; TW vs CM, p<0.0001). CONCLUSION: CPC in non-athlete TW showed an intermediate pattern between that in CW and CM. The mean strength and VO2 peak in non-athlete TW while performing physical exertion were higher than those in non-athlete CW and lower than those in CM.

Allelic Variants in Established Hypopituitarism Genes Expand Our Knowledge of the Phenotypic Spectrum.

We report four allelic variants (three novel) in three genes previously established as causal for hypopituitarism or related disorders. A novel homozygous variant in the growth hormone gene, GH1 c.171delT (p.Phe 57Leufs*43), was found in a male patient with severe isolated growth hormone deficiency (IGHD) born to consanguineous parents. A hemizygous SOX3 allelic variant (p.Met304Ile) was found in a male patient with IGHD and hypoplastic anterior pituitary. YASARA, a tool to evaluate protein stability, suggests that p.Met304Ile destabilizes the SOX3 protein (ΔΔG = 2.49 kcal/mol). A rare, heterozygous missense variant in the TALE homeobox protein gene, TGIF1 (c.268C>T:p.Arg90Cys) was found in a patient with combined pituitary hormone deficiency (CPHD), diabetes insipidus, and syndromic features of holoprosencephaly (HPE). This variant was previously reported in a patient with severe holoprosencephaly and shown to affect TGIF1 function. A novel heterozygous TGIF1 variant (c.82T>C:p.Ser28Pro) was identified in a patient with CPHD, pituitary aplasia and ectopic posterior lobe. Both TGIF1 variants have an autosomal dominant pattern of inheritance with incomplete penetrance. In conclusion, we have found allelic variants in three genes in hypopituitarism patients. We discuss these variants and associated patient phenotypes in relation to previously reported variants in these genes, expanding our knowledge of the phenotypic spectrum in patient populations.

Adverse Outcomes and Economic Burden of Congenital Adrenal Hyperplasia Late Diagnosis in the Newborn Screening Absence.

OBJECTIVE: To establish short- and long-term adverse outcome frequencies related to a late diagnosis of congenital adrenal hyperplasia (CAH) in the absence of newborn screening (NBS) and to determine respective treatment costs, which have never been reported. DESIGN: A retrospective analysis of a CAH cohort diagnosed without NBS. METHODS: We evaluated medical record data concerning 195 patients (141 females) diagnosed with CAH through clinical suspicion and confirmed using hormonal and CYP21A2 analysis, who were followed from 1980 to 2016 at Sao Paulo University. We measured mortality, dehydration, mental impairment frequencies, and hospitalization length outcomes in the salt-wasting form; the frequency of genetic females raised as males in both forms, frequency of depot GnRh analog (GnRha) and GH therapies in the simple virilizing form, and related outcome costs were calculated. RESULTS: Mortality rates and associated costs, varying from 10% to 26% and from $2,239,744.76 to $10,271,591.25, respectively, were calculated using the Brazilian yearly live-births rate, estimated productive life years, and gross domestic product. In the salt-wasting form, 76% of patients were hospitalized, 8.6% were mentally impaired, and 3% of females were raised as males (total cost, $86,230/salt-wasting patient). GnRha and growth hormone were used for 28% and 14% of simple virilizing patients, respectively, and 18% of females were raised as males (preventable cost, $4232.74/simple virilizing patient). CONCLUSIONS: A late CAH diagnosis leads to high mortality and morbidity rates, notably increasing public health costs, and may result in physical and psychological damage that is not easily measurable.

Androgen insensitivity syndrome: a review.

Androgenic insensitivity syndrome is the most common cause of disorders of sexual differentiation in 46,XY individuals. It results from alterations in the androgen receptor gene, leading to a frame of hormonal resistance, which may present clinically under 3 phenotypes: complete (CAIS), partial (PAIS) or mild (MAIS). The androgen receptor gene has 8 exons and 3 domains, and allelic variants in this gene occur in all domains and exons, regardless of phenotype, providing a poor genotype - phenotype correlation in this syndrome. Typically, laboratory diagnosis is made through elevated levels of LH and testosterone, with little or no virilization. Treatment depends on the phenotype and social sex of the individual. Open issues in the management of androgen insensitivity syndromes includes decisions on sex assignment, timing of gonadectomy, fertility, physcological outcomes and genetic counseling.

Low estrogen doses normalize testosterone and estradiol levels to the female range in transgender women.

OBJECTIVE: The ideal dosage of cross-sex hormones remains unknown. The aim of this study was to evaluate the luteinizing hormone, follicle-stimulating hormone, testosterone, estradiol and prolactin levels after low-dose estrogen therapy with or without cyproterone acetate in transgender women. METHODS: The serum hormone and biochemical profiles of 51 transgender women were evaluated before gonadectomy. Hormone therapy consisted of conjugated equine estrogen alone or combined with cyproterone acetate. The daily dose of conjugated equine estrogen was 0.625 mg in 41 subjects and 1.25 mg in 10 subjects, and the daily dose of cyproterone acetate was 50 mg in 42 subjects and 100 mg in one subject. RESULTS: Estrogen-only therapy reduced the testosterone, luteinizing hormone and follicle-stimulating hormone levels from 731.5 to 18 ng/dL, 6.3 to 1.1 U/L and 9.6 to 1.5 U/L, respectively. Estrogen plus cyproterone acetate reduced the testosterone, luteinizing hormone and follicle-stimulating hormone levels from 750 to 21 ng/dL, 6.8 to 0.6 U/L and 10 to 1.0 U/L, respectively. The serum levels of luteinizing hormone, follicle-stimulating hormone, testosterone, estradiol and prolactin in the patients treated with estrogen alone and estrogen plus cyproterone acetate were not significantly different. The group receiving estrogen plus cyproterone acetate had significantly higher levels of gamma-glutamyltransferase than the group receiving estrogen alone. No significant differences in the other biochemical parameters were evident between the patients receiving estrogen alone and estrogen plus cyproterone acetate. CONCLUSION: In our sample of transgender women, lower estrogen doses than those usually prescribed for these subjects were able to adjust the testosterone and estradiol levels to the physiological female range, thus avoiding high estrogen doses and their multiple associated side effects.

Androgen insensitivity syndrome: a review

ABSTRACT Androgenic insensitivity syndrome is the most common cause of disorders of sexual differentiation in 46,XY individuals. It results from alterations in the androgen receptor gene, leading to a frame of hormonal resistance, which may present clinically under 3 phenotypes: complete (CAIS), partial (PAIS) or mild (MAIS). The androgen receptor gene has 8 exons and 3 domains, and allelic variants in this gene occur in all domains and exons, regardless of phenotype, providing a poor genotype - phenotype correlation in this syndrome. Typically, laboratory diagnosis is made through elevated levels of LH and testosterone, with little or no virilization. Treatment depends on the phenotype and social sex of the individual. Open issues in the management of androgen insensitivity syndromes includes decisions on sex assignment, timing of gonadectomy, fertility, physcological outcomes and genetic counseling.

Low estrogen doses normalize testosterone and estradiol levels to the female range in transgender women

OBJECTIVE: The ideal dosage of cross-sex hormones remains unknown. The aim of this study was to evaluate the luteinizing hormone, follicle-stimulating hormone, testosterone, estradiol and prolactin levels after low-dose estrogen therapy with or without cyproterone acetate in transgender women. METHODS: The serum hormone and biochemical profiles of 51 transgender women were evaluated before gonadectomy. Hormone therapy consisted of conjugated equine estrogen alone or combined with cyproterone acetate. The daily dose of conjugated equine estrogen was 0.625 mg in 41 subjects and 1.25 mg in 10 subjects, and the daily dose of cyproterone acetate was 50 mg in 42 subjects and 100 mg in one subject. RESULTS: Estrogen-only therapy reduced the testosterone, luteinizing hormone and follicle-stimulating hormone levels from 731.5 to 18 ng/dL, 6.3 to 1.1 U/L and 9.6 to 1.5 U/L, respectively. Estrogen plus cyproterone acetate reduced the testosterone, luteinizing hormone and follicle-stimulating hormone levels from 750 to 21 ng/dL, 6.8 to 0.6 U/L and 10 to 1.0 U/L, respectively. The serum levels of luteinizing hormone, follicle-stimulating hormone, testosterone, estradiol and prolactin in the patients treated with estrogen alone and estrogen plus cyproterone acetate were not significantly different. The group receiving estrogen plus cyproterone acetate had significantly higher levels of gamma-glutamyltransferase than the group receiving estrogen alone. No significant differences in the other biochemical parameters were evident between the patients receiving estrogen alone and estrogen plus cyproterone acetate. CONCLUSION: In our sample of transgender women, lower estrogen doses than those usually prescribed for these subjects were able to adjust the testosterone and estradiol levels to the physiological female range, thus avoiding high estrogen doses and their multiple associated side effects.

Association Study of GWAS-Derived Loci with Height in Brazilian Children: Importance of MAP3K3, MMP24 and IGF1R Polymorphisms for Height Variation.

BACKGROUND/AIM: The single nucleotide polymorphisms (SNPs) rs2282978 (CDK6), rs2425019 (MMP24), rs8081612 (MAP3K3), rs2871865 (IGF1R) and rs3782415 (SOCS2) were among the SNPs most strongly associated with height in a meta-analysis of 47 genome-wide association studies (GWAS) involving 114,223 adults from six ethnic groups. The present study aimed to examine associations between these SNPs and height in Brazilian children. METHODS: Cross-sectional heights of 1,008 healthy unrelated 4.4- to 9.7-year-old children were evaluated. All genotypes were determined by allele-specific polymerase chain reactions. Height standard deviation scores (SDS) were generated for this population and regressed on allele counts. Linear regressions were performed to estimate the effect of individual SNPs or a polygenic allelic score on height. RESULTS: The T allele of rs8081612 (MAP3K3), the C allele of rs2871865 (IGF1R) and the G allele of rs2425019 (MMP24) were significantly associated with a 0.091-SDS greater height (95% CI 0.089-0.093, p = 0.001) by polygenic analysis. The mean height SDS difference between children with 2 'tall' alleles and children with 4 'tall' alleles was 0.24 SDS (95% CI 0.05-0.43, p = 0.01). The observed allelic effect is consistent with that found in previous GWAS. CONCLUSIONS: Polymorphisms in MAP3K3, MMP24 and IGF1R act additively on height in children of an admixed population. These results demonstrate the importance of these loci for children's height.

[Analysis of an iodide radioimmunoassay for 11-deoxicortisol measurement]. / Análise de um radioimunoensaio iodado para determinação de 11-deoxicortisol.

OBJECTIVE: Our aim was to correlate 11-deoxycortisol levels obtained by two currently available techniques for 11-deoxycortisol measurement: radioimmunoassay, and high performance liquid chromatography followed by tandem mass spectrometry (MS/MS). The latter is the gold standard method for steroid hormone measurement. MATERIALS AND METHODS: We selected 88 samples and the results of these two methods were compared by Deming regression. RESULTS: The analytical sensitivity of the RIA was 0.30 ng/mL, with inadequate linearity and inadequate precision profile (34% of the samples had a CV ≥ 20%). From the selected samples, 54 had measurable levels of 11-deoxycortisol in both methods and were used in the comparison. The comparison of RIA with LC-MS/MS showed an overestimation of the results by RIA. The correlation coefficient was 0.610; linear regression slope was 3.751; and the intercept was 0.145, indicating a poor correlation between the two methods. CONCLUSION: We concluded that 11-deoxycortisol measured by radioimmunoassay, despite a good analytical sensitivity, showed very low specificity, precluding its use as a reliable method for 11-deoxycortisol measurement.

Análise de um radioimunoensaio iodado para determinação de 11-deoxicortisol / Analysis of an iodide radioimmunoassay for 11-deoxicortisol measurement

Objetivo : Nosso objetivo foi comparar duas técnicas de dosagem do 11-desoxicortisol: a técnica de radioimunoensaio iodado, a qual foi validada neste trabalho, e a cromatografia líquida de alta performance seguida por espectrometria de massa em tandem (LC-MS/MS), sendo a última considerada o padrão-ouro para dosagem dos hormônios esteroides. Materiais e métodos : Para a comparação entre os resultados de 11-desoxicortisol, foram selecionadas 88 amostras. Resultados : A sensibilidade analítica do radioimunoensaio foi de 0,30 ng/mL, com linearidade e perfil de precisão inadequado (34% das amostras com CV ≥ 20%). Das 88 amostras selecionadas, apenas 54 apresentaram resultados mensuráveis em ambos os métodos. A comparação desses resultados, por meio da regressão de Deming, resultou em um coeficiente de correlação de 0,610, inclinação de 3,751, intercepção de 0,145, evidenciando a pobre correlação entre os resultados e a superestimação dos resultados pelo RIA. Conclusão : Concluímos que o método de dosagem de 11-desoxicortisol por radioimunoensaio iodado apresentou resultados inadequados nos diversos parâmetros avaliados, inviabilizando sua utilização como método de dosagem do 11-desoxicortisol. Arq Bras Endocrinol Metab. 2014;58(3):232-6 .

Objective : Our aim was to correlate 11-deoxycortisol levels obtained by two currently available techniques for 11-deoxycortisol measurement: radioimmunoassay, and high performance liquid chromatography followed by tandem mass spectrometry (MS/MS). The latter is the gold standard method for steroid hormone measurement. Materials and methods : We selected 88 samples and the results of these two methods were compared by Deming regression. Results : The analytical sensitivity of the RIA was 0.30 ng/mL, with inadequate linearity and inadequate precision profile (34% of the samples had a CV ≥ 20%). From the selected samples, 54 had measurable levels of 11-deoxycortisol in both methods and were used in the comparison. The comparison of RIA with LC-MS/MS showed an overestimation of the results by RIA. The correlation coefficient was 0.610; linear regression slope was 3.751; and the intercept was 0.145, indicating a poor correlation between the two methods. Conclusion : We concluded that 11-deoxycortisol measured by radioimmunoassay, despite a good analytical sensitivity, showed very low specificity, precluding its use as a reliable method for 11-deoxycortisol measurement. Arq Bras Endocrinol Metab. 2014;58(3):232-6 .

Analysis of anti-Müllerian hormone (AMH) and its receptor (AMHR2) genes in patients with persistent Müllerian duct syndrome / Pesquisa de mutações nos genes do hormônio antiMülleriano (AMH) e do seu receptor (AMHR2) em pacientes com síndrome de persistência dos ductos Müllerianos

OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8.

OBJETIVO: Analisar os genes AMH e AMHR2 em indivíduos com síndrome de persistência dos ductos de Müller (SPDM). PACIENTES E MÉTODO: Amostras de DNA genômico de oito pacientes com SPDM foram obtidas de leucócitos de sangue periférico. Sequenciamento direto da região codificadora e das áreas intrônicas próximas aos éxons dos genes AMH e AMHR foi realizado. RESULTADOS: As mutações p.Arg95*, p.Arg123Trp, c.556-2A>G e p.Arg502Leu no gene AMH foram identificadas em cinco pacientes e as mutações p.Gly323Ser e p.Arg407* no gene AMHR2, em dois indivíduos. As análises in silico das mutações c.556-2A>G, p.Arg502Leu e p.Arg407*, não descritas anteriormente na literatura, previram que elas são deletérias e possivelmente a causa da doença. CONCLUSÃO: Uma provável etiologia molecular foi encontrada nos oito pacientes portadores de SPDM avaliados. No gene do AMH foram identificadas quatro mutações e no AMHR2, duas mutações. Três das seis mutações encontradas são mutações novas, c.556-2A>G e p.Arg502Leu no gene AMH; e p.Gly323Ser no AMHR2. Arq Bras Endocrinol Metab. 2012;56(8):473-8.

Novel mutation in the gonadotropin-releasing hormone receptor (GNRHR) gene in a patient with normosmic isolated hypogonadotropic hypogonadism / Nova mutação no receptor do hormônio liberador de gonadotrofinas (GNRHR) em um paciente com hipogonadismo hipogonadotrófico isolado normósmico

We report a novel GNRHR mutation in a male with normosmic isolated hypogonadotropic hypogonadism (nIHH). The coding region of the GNRHR gene was amplified and sequenced. Three variants p.[Asn10Lys;Gln11Lys]; [Tyr283His] were identified in the GNRHR coding region in a male with sporadic complete nIHH. The three variants were absent in the controls (130 normal adults). Familial segregation showed that the previously described p.Asn10Lys and p.Gln11Lys are in the same allele, in compound heterozygozity with the novel variant p.Tyr283His. The p.[Asn10Lys;Gln11Lys] are known inactivating mutations. The p.Tyr283His affects a well-conserved residue, and in silico analysis suggested it is a deleterious variant. We describe a novel GNRHR mutation in a male with nIHH. Absence of the mutation in the control group, conservation among species, in silico analysis, and familial segregation suggest that p.Tyr283His, which was identified in compound heterozygozity with the p.[Asn10Lys;Gln11Lys] variants, is an inactivating mutation. Arq Bras Endocrinol Metab. 2012;56(8):540-4.

Relatamos uma nova mutação no gene GNRHR em um homem com hipogonadismo hipogonadotrófico isolado normósmico (HHIn). A região codificadora do gene GNRHR foi amplificada e sequenciada. Três variantes p.[Asn10Lys;Gln11Lys]; [Tyr283His] foram identificadas no GNRHR em um homem com HHIn esporádico. As três variantes estavam ausentes no grupo controle (130 adultos normais). A segregação familiar mostrou que as variantes previamente descritas p.[Asn10Lys;Gln11Lys] se localizavam no mesmo alelo, em heterozigose composta com a nova variante p.Tyr283His. As mutações p.[Asn10Lys;Gln11Lys] são sabidamente inativadoras. A variante p.Tyr283His afeta um resíduo bem conservado, e a análise in silico sugeriu que essa é uma mutação deletéria. Descrevemos uma mutação inédita no gene GNRHR em um paciente com HHIn nIHH. A ausência da variante no grupo controle, a conservação entre as espécies, a análise in silico e a segregação familiar sugerem que a p.Tyr283His é uma mutação inativadora, identificada em heterozigose composta com as mutações p.[Asn10Lys;Gln11Lys]. Arq Bras Endocrinol Metab. 2012;56(8):540-4.

Analysis of anti-Müllerian hormone (AMH) and its receptor (AMHR2) genes in patients with persistent Müllerian duct syndrome.

OBJECTIVE: To screen for mutations in AMH and AMHR2 genes in patients with persistent Müllerian duct syndrome (PMDS). PATIENTS AND METHOD: Genomic DNA of eight patients with PMDS was obtained from peripheral blood leukocytes. Directed sequencing of the coding regions and the exon-intron boundaries of AMH and AMHR2 were performed. RESULTS: The AMH mutations p.Arg95*, p.Arg123Trp, c.556-2A>G, and p.Arg502Leu were identified in five patients; and p.Gly323Ser and p.Arg407* in AMHR2 of two individuals. In silico analyses of the novel c.556-2A>G, p.Arg502Leu and p.Arg407* mutations predicted that they were harmful and were possible causes of the disease. CONCLUSION: A likely molecular etiology was found in the eight evaluated patients with PMDS. Four mutations in AMH and two in AMHR2 were identified. Three of them are novel mutations, c.556-2A>G, and p.Arg502Leu in AMH; and p.Gly323Ser in AMHR2.

Novel mutation in the gonadotropin-releasing hormone receptor (GNRHR) gene in a patient with normosmic isolated hypogonadotropic hypogonadism.

We report a novel GNRHR mutation in a male with normosmic isolated hypogonadotropic hypogonadism (nIHH). The coding region of the GNRHR gene was amplified and sequenced. Three variants p.[Asn10Lys;Gln11Lys]; [Tyr283His] were identified in the GNRHR coding region in a male with sporadic complete nIHH. The three variants were absent in the controls (130 normal adults). Familial segregation showed that the previously described p.Asn10Lys and p.Gln11Lys are in the same allele, in compound heterozygozity with the novel variant p.Tyr283His. The p.[Asn10Lys;Gln11Lys] are known inactivating mutations. The p.Tyr283His affects a well-conserved residue, and in silico analysis suggested it is a deleterious variant. We describe a novel GNRHR mutation in a male with nIHH. Absence of the mutation in the control group, conservation among species, in silico analysis, and familial segregation suggest that p.Tyr283His, which was identified in compound heterozygozity with the p.[Asn10Lys;Gln11Lys] variants, is an inactivating mutation.

Uma rara causa de dispnéia com apresentação singular na tomografia computadorizada de tórax: síndrome de ativação macrofágica / A very rare cause of dyspnea with a unique presentation on a computed tomography scan of the chest: macrophage activation syndrome

A síndrome de ativação macrofágica é uma doença rara e potencialmente fatal. Ela ocorre devido a uma alteração no sistema imunológico, com excessiva proliferação de macrófagos, geralmente causando hepatoesplenomegalia, pancitopenia e disfunção hepática. Neste artigo, relatamos uma raríssima apresentação da síndrome de ativação macrofágica como insuficiência respiratória, bem como a primeira descrição de nódulo escavado, vidro fosco e consolidação na tomografia computadorizada de alta resolução de pulmão (simulando uma pneumonia ou hemorragia alveolar) e o sucesso terapêutico com o uso de imunoglobulina humana. Assim, sugerimos que a síndrome de ativação macrofágica seja colocada no diagnóstico diferencial de causas de insuficiência respiratória e que o rápido diagnóstico e tratamento seja imperativo para a boa evolução do paciente.

Macrophage activation syndrome is a rare and potentially life-threatening disease. It occurs due to immune dysregulation manifested as excessive macrophage proliferation, typically causing hepatosplenomegaly, pancytopenia and hepatic dysfunction. Here, we report an unusual case of macrophage activation syndrome presenting as dyspnea, as well as (reported here for the first time) high resolution computed tomography findings of an excavated nodule, diffuse ground glass opacities and consolidations (mimicking severe pneumonia or alveolar hemorrhage). The patient was successfully treated with human immunoglobulin. We recommend that macrophage activation syndrome be considered in the differential diagnosis of respiratory failure. Rapid diagnosis and treatment are essential to achieving favorable outcomes in patients with this syndrome.

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction

A determinaçäo do sexo fetal e essencial para o diagnóstico pré-natal de doenças relacionadas ao sexo como hiperplasia adrenal congenita e sindrome de insensibilidade androgenica. As tecnicas de biologia molecular identificam a presença do cromossomo Y através de metodologia mais fácil e rapida do que a técnica citogenetica convencional. Utilizamos DNA extraido de vilo corionico de oito biopsias realizadas entre a 10 e 12 semanas de gestaçäo, para amplificar um fragmento de 778 pb correspondente a sequencia do gene SRY ("primers" XES10-XES11) na determinaçäo do sexo fetal. Como controle interno da reaçäo amplificamos simultaneamente um fragmento de 650 pb do exon 6-8 do gene CYP21B, gene ativo da 21 hidroxilase ("primers" 5' GAGGGATCACATCGTCGTGGAGATG3' e 5'TTCGTGGTCTAGCTCCTCCTG3'). O protocolo utilizado na PCR foi 94 graus C - 2 min; 32 ciclos: 94 graus C - 1 min, 63 graus C - 1 min, 72 graus C- 2 min e um ciclo de extensäo de 72 graus C - 10 min. Para confirmaçäo dos resultados da PCR realizou-se cariotipo a partir de cultura de células obtidas atraves de biopsia de vilosidade corionica. Em um caso o material näo foi suficiente para a realizaçäo do cariotipo. Este protocolo foi testado em 200 amostras de DNA extraido de leucocitos de homens e mulheres normais. A amplificaçäo do gene CYP21B ocorreu em todas as amostras enquanto a amplificaçäo do gene SRY apenas nas amostras dos homens. Das oito amostras de DNA extraidas de vilo corionico o gene SRY foi positivo em tres fetos masculinos e negativo nos cinco fetos femininos. O sexo fetal foi confirmado pelo cariotipo ou após o nascimento. Nos concluimos que este protocolo representa um método fácil, rapido e seguro de determinaçäo do sexo fetal

Feocromocitoma vesical: relato de caso e revisao da literatura / Pheochromocytoma of the urinary bladder: a case report and review of the literature

O feocromocitoma e um tumor raro, encontrado em 0,1 por cento dos pacientes hipertensos. Os feocromocitomas extra-adrenais ocorrem em 18 por cento dos casos, e destes 10 por cento sao encontrados na bexiga. Descreveremos um caso de feocromocitoma vesical em um homem de 40 anos que por seis anos apresentou crises tipicas com tremores, cefaleia e palpitacao desencadeadas pela miccao. A determinacao das catecolaminas urinaria identificou um aumento nos niveis...

Estudo comparativo das neovaginas formadas pelas técnicas de McIndoe e de Frank / A comparative study of neovagine formed by Mcindo's techinique to the Frank's one

Com o objetivo de comparar as neovaginas formadas pelas técnicas de McIndoe e de Frank, foram estudadas vinte e uma pacientes portadoras de agenesia da vagina. Doze delas haviam sido submetidas a correçäo cirurgica pela técnica de McIndoe (grupo A), enquanto as outras nove haviam sido tratadas pela técnica näo cruenta de Frank, ou seja, pela invaginaçäo da fosseta vaginal sob pressäo, usando-se dilatadores de calibres progressivamente maiores (grupo B). em todos os casos, foram reavaliados exame clínico, estudo bistologico e bacteriológico, medida do pH e citologia hormonal...

MRI of congenital pituitary insuficiency

Foram analisadas as imagens obtidas em aparelho de 1,5 Tesla, 193 pacientes portadores de insuficiencia pituitaria congenita. Cento e trinta e nove pacientes eram portadores de deficit isolado de hormonio de crescimento e os outros 54 pacientes apresentavam multiplas deficiencias de hormonios pituitarios. Os lobos anterior e posterior da glandula pituitaria normal podem ser perfeitamente diferenciados a RM devido ao hipersinal caracteristico do lobo posterior em sequencias pesadas em T1...